rs524441 chr11:83250016 G>A
- Sequence
ttccattttctatattacagatga[G/A]ttgacatggtcagtggataaataa
- ASB in cell types
- K562 (myelogenous leukemia) SK-N-SH (neuroblastoma)
View in PheLiGe Color scale
-log10 FDR of Ref (G) ASB
-log10 FDR of Alt (A) ASB
Details
Transcription factors
Cell types
Cell type | Effect size Ref | Effect size Alt | FDR Ref | FDR Alt | Mean BAD | |
|---|---|---|---|---|---|---|
| K562 (myelogenous leukemia) | 0.52 | -0.17 | 2.01 | |||
| SK-N-SH (neuroblastoma) | 1.13 | -1.42 | 1.33 |
Items per page:
1 – 2 of 2
Motif analysis
No data available
Genetic associations
GRASP advanced age-related macular degeneration, advanced age-related macular degeneration (choroidal neovascularization) vs. no amd, bipolar disorder, triglycerides
GTEx eQTL Adipose_Subcutaneous, Artery_Aorta, Artery_Coronary, Artery_Tibial, Brain_Cerebellar_Hemisphere, Brain_Cerebellum, Cells_Cultured_fibroblasts, Colon_Sigmoid, Colon_Transverse, Esophagus_Muscularis, Muscle_Skeletal, Nerve_Tibial, Pancreas, Skin_Sun_Exposed_Lower_leg, Stomach, Testis, Thyroid