rs524902 chr2:218568634 A>C
- Sequence
ccgccgttcactggcttttggagg[A/C]gggtcagagttcacgccgctctct
- ASB in cell types
- HepG2 (hepatoblastoma) HEK293T (embryonic kidney) HEK293 (embryonic kidney) A549 (lung carcinoma)
- ASB for transcription factors
- LMBL2_HUMAN GABPA_HUMAN CREB1_HUMAN EP300_HUMAN
View in PheLiGe Color scale
-log10 FDR of Ref (A) ASB
-log10 FDR of Alt (C) ASB
Details
Transcription factors
Cell types
Uniprot ID | Effect size Ref | Effect size Alt | FDR Ref | FDR Alt | Mean BAD | Motif fold change | Motif concordance | |
|---|---|---|---|---|---|---|---|---|
| LMBL2_HUMAN | n/a | 0.78 | 2.00 | n/a | n/a | |||
| GABPA_HUMAN | 1.73 | 0.07 | 1.78 | n/a | No Hit | |||
| CREB1_HUMAN | 1.30 | -0.13 | 1.78 | n/a | No Hit | |||
| EP300_HUMAN | 0.01 | 0.97 | 1.42 | n/a | n/a | |||
| CTCF_HUMAN | 0.59 | 0.50 | 1.28 | n/a | No Hit |
Items per page:
1 – 5 of 8
Motif analysis
No data available
Genetic associations
GTEx eQTL Adipose_Subcutaneous, Adipose_Visceral_Omentum, Artery_Aorta, Artery_Coronary, Artery_Tibial, Brain_Caudate_basal_ganglia, Brain_Cerebellar_Hemisphere, Brain_Cerebellum, Brain_Cortex, Brain_Frontal_Cortex_BA9, Breast_Mammary_Tissue, Cells_Cultured_fibroblasts, Colon_Transverse, Esophagus_Gastroesophageal_Junction, Esophagus_Mucosa, Liver, Lung, Muscle_Skeletal, Nerve_Tibial, Pancreas, Skin_Not_Sun_Exposed_Suprapubic, Skin_Sun_Exposed_Lower_leg, Spleen, Stomach, Testis, Thyroid, Whole_Blood