rs525339 chr20:3696367 C>T
- Sequence
agtgctcccaccaagcaagccact[C/T]tgtgaattgccattgcctcctagt
- ASB in cell types
- foreskin keratinocyte 22RV1 (prostate carcinoma)
View in PheLiGe Color scale
-log10 FDR of Ref (C) ASB
-log10 FDR of Alt (T) ASB
Details
Transcription factors
Cell types
Cell type | Effect size Ref | Effect size Alt | FDR Ref | FDR Alt | Mean BAD | |
|---|---|---|---|---|---|---|
| foreskin keratinocyte | 1.14 | -2.30 | 2.33 | |||
| 22RV1 (prostate carcinoma) | -0.55 | 0.94 | 1.00 |
Items per page:
1 – 2 of 2