rs525420 chr19:7871322 A>G
- Sequence
gtagaggccggccgagaaggtgag[A/G]tcaaagaagcttgggtttgcctag
- ASB in cell types
- K562 (myelogenous leukemia)
- ASB for transcription factors
- HDAC1_HUMAN
View in PheLiGe Color scale
-log10 FDR of Ref (A) ASB
-log10 FDR of Alt (G) ASB
Details
Transcription factors
Cell types
Uniprot ID | Effect size Ref | Effect size Alt | FDR Ref | FDR Alt | Mean BAD | Motif fold change | Motif concordance | |
|---|---|---|---|---|---|---|---|---|
| HDAC1_HUMAN | 1.93 | -1.36 | 2.00 | n/a | n/a |
Items per page:
1 – 1 of 1
Motif analysis
No data available
Genetic associations
GRASP barnes akathisia rating scale, cystatin c in serum, ldl cholesterol, resistance to kuru in aged women despite likely exposure, sporadic creutzfeldt-jakob disease, triglycerides
GTEx eQTL Brain_Cerebellum, Esophagus_Mucosa, Lung, Pancreas, Pituitary, Skin_Not_Sun_Exposed_Suprapubic, Skin_Sun_Exposed_Lower_leg, Spleen, Stomach, Thyroid, Whole_Blood