rs525983 chr3:172356171 G>A
- Sequence
tcataaatcattttgtcataacaa[G/A]gtgagatgggctttactaggagac
- ASB in cell types
- HEK293 (embryonic kidney)
View in PheLiGe Color scale
-log10 FDR of Ref (G) ASB
-log10 FDR of Alt (A) ASB
Details
Transcription factors
Cell types
Cell type | Effect size Ref | Effect size Alt | FDR Ref | FDR Alt | Mean BAD | |
|---|---|---|---|---|---|---|
| HEK293 (embryonic kidney) | 0.21 | 0.73 | 1.51 |
Items per page:
1 – 1 of 1
Motif analysis
No data available
Genetic associations
GRASP aortic valve calcium, height, ldl cholesterol change with statins, total cholesterol change with statins, waist hip ratio