rs526260 chr18:79793173 A>G
- Sequence
tcctcatttccaccttcagtgaac[A/G]cttgcggacagcatgcttcagagc
- ASB in cell types
- periferal blood macrophages
View in PheLiGe Color scale
-log10 FDR of Ref (A) ASB
-log10 FDR of Alt (G) ASB
Details
Transcription factors
Cell types
Cell type | Effect size Ref | Effect size Alt | FDR Ref | FDR Alt | Mean BAD | |
|---|---|---|---|---|---|---|
| periferal blood macrophages | 1.25 | 0.19 | 2.00 |
Items per page:
1 – 1 of 1
Motif analysis
No data available
Genetic associations
GRASP advanced age-related macular degeneration, advanced age-related macular degeneration (choroidal neovascularization) vs. no amd, height, irritible bowel syndrome, maternal transmission distortion, total cholesterol
GTEx eQTL Adipose_Visceral_Omentum, Brain_Cerebellar_Hemisphere, Cells_Cultured_fibroblasts, Lung, Muscle_Skeletal, Nerve_Tibial, Prostate, Testis, Thyroid, Whole_Blood