rs5268 chr2:231925343 C>T
- Sequence
ggcggctcgcgcgcctccgaaggc[C/T]ggctgggcggcgggcggtcccggg
- ASB in cell types
- LNCaP (prostate carcinoma) HepG2 (hepatoblastoma)
View in PheLiGe Color scale
-log10 FDR of Ref (C) ASB
-log10 FDR of Alt (T) ASB
Details
Transcription factors
Cell types
Cell type | Effect size Ref | Effect size Alt | FDR Ref | FDR Alt | Mean BAD | |
|---|---|---|---|---|---|---|
| LNCaP (prostate carcinoma) | -2.11 | 1.73 | 1.78 | |||
| HepG2 (hepatoblastoma) | 0.73 | -0.07 | 1.98 |
Items per page:
1 – 2 of 2