rs527313 chr4:13920711 G>A
- Sequence
agcttgcagtgattcactctgcaa[G/A]taccttgattcacccagcccacac
- ASB in cell types
- 786-O (renal carcinoma)
- ASB for transcription factors
- JUN_HUMAN
View in PheLiGe Color scale
-log10 FDR of Ref (G) ASB
-log10 FDR of Alt (A) ASB
Details
Transcription factors
Cell types
Uniprot ID | Effect size Ref | Effect size Alt | FDR Ref | FDR Alt | Mean BAD | Motif fold change | Motif concordance | |
|---|---|---|---|---|---|---|---|---|
| JUN_HUMAN | n/a | 1.76 | 1.75 | n/a | No Hit |
Items per page:
1 – 1 of 1
Motif analysis
No data available
Genetic associations
GRASP biploar disorder (bipolar schizoaffective disorder), college completion, hdl cholesterol change with statins, hypertension (early onset hypertension), late onset alzheimers disease, maternal transmission distortion, triglycerides, ulcerative colitis