rs528847 chr1:229781721 T>C
- Sequence
aggcacactggcatgtggtttgca[T/C]ggccggacaagccaccaggtggct
- ASB in cell types
- T47D (invasive ductal carcinoma) LNCaP (prostate carcinoma)
View in PheLiGe Color scale
-log10 FDR of Ref (T) ASB
-log10 FDR of Alt (C) ASB
Details
Transcription factors
Cell types
Cell type | Effect size Ref | Effect size Alt | FDR Ref | FDR Alt | Mean BAD | |
|---|---|---|---|---|---|---|
| T47D (invasive ductal carcinoma) | 1.40 | -0.78 | 1.56 | |||
| LNCaP (prostate carcinoma) | 0.94 | -0.29 | 1.40 |
Items per page:
1 – 2 of 2