rs528971 chr2:233857435 C>T
- Sequence
ctcccttaatgccattctctgtaa[C/T]acctcaccctaccacccttggcag
- ASB in cell types
- pancreas HCT-116-RAD21-mAC
View in PheLiGe Color scale
-log10 FDR of Ref (C) ASB
-log10 FDR of Alt (T) ASB
Details
Transcription factors
Cell types
Cell type | Effect size Ref | Effect size Alt | FDR Ref | FDR Alt | Mean BAD | |
|---|---|---|---|---|---|---|
| pancreas | -2.08 | 1.97 | 1.00 | |||
| HCT-116-RAD21-mAC | -1.29 | 1.51 | 1.33 |
Items per page:
1 – 2 of 2