rs529224 chr1:100352622 G>C
- Sequence
tgatcactttggaagccgggggaa[G/C]actttgccctgccctgagagctgg
- ASB in cell types
- K562 (myelogenous leukemia) HEK293 (embryonic kidney) GM12878 (female B-cells)
- ASB for transcription factors
- HDAC1_HUMAN KDM1A_HUMAN
View in PheLiGe Color scale
-log10 FDR of Ref (G) ASB
-log10 FDR of Alt (C) ASB
Details
Transcription factors
Cell types
Uniprot ID | Effect size Ref | Effect size Alt | FDR Ref | FDR Alt | Mean BAD | Motif fold change | Motif concordance | |
|---|---|---|---|---|---|---|---|---|
| HDAC1_HUMAN | 1.72 | -0.72 | 1.78 | n/a | n/a | |||
| KDM1A_HUMAN | 1.56 | -0.97 | 1.33 | n/a | n/a |
Items per page:
1 – 2 of 2
Motif analysis
No data available
Genetic associations
GRASP cystatin c in serum, ldl cholesterol, ldl cholesterol change with statins, microalbuminuria, serum creatinine, triglycerides, triglycerides change with statins
GTEx eQTL Adipose_Subcutaneous, Adipose_Visceral_Omentum, Artery_Aorta, Artery_Tibial, Cells_Cultured_fibroblasts, Colon_Sigmoid, Colon_Transverse, Esophagus_Mucosa, Esophagus_Muscularis, Liver, Muscle_Skeletal, Nerve_Tibial, Ovary, Pancreas, Skin_Not_Sun_Exposed_Suprapubic, Spleen, Thyroid, Whole_Blood