rs529269 chr9:98710639 A>G
- Sequence
cctaacttctctttccaggcttct[A/G]tagactccacctctcccggctcca
- ASB in cell types
- HL-60 (acute myeloid leukemia)
- ASB for transcription factors
- REST_HUMAN
View in PheLiGe Color scale
-log10 FDR of Ref (A) ASB
-log10 FDR of Alt (G) ASB
Details
Transcription factors
Cell types
Uniprot ID | Effect size Ref | Effect size Alt | FDR Ref | FDR Alt | Mean BAD | Motif fold change | Motif concordance | |
|---|---|---|---|---|---|---|---|---|
| REST_HUMAN | 2.44 | -0.30 | 1.33 | 2.25 | Discordant |
Items per page:
1 – 1 of 1
Motif analysis
Genetic associations
GRASP advanced age-related macular degeneration (geographic atrophy), cognitive response of healthy volunteers to topiramate treatment as measure by the digit span forward cognitive test, fasting blood glucose, hdl cholesterol, nausea in response to topiramate treatment in healthy volunteers, total cholesterol