rs5295 chr8:142874500 C>G
- Sequence
tgtttcagcacctaggacagaagc[C/G]gggtttccatctggcttggtccgc
- ASB in cell types
- A549 (lung carcinoma) GM12878 (female B-cells)
View in PheLiGe Color scale
-log10 FDR of Ref (C) ASB
-log10 FDR of Alt (G) ASB
Details
Transcription factors
Cell types
Cell type | Effect size Ref | Effect size Alt | FDR Ref | FDR Alt | Mean BAD | |
|---|---|---|---|---|---|---|
| A549 (lung carcinoma) | 1.45 | 0.05 | 1.39 | |||
| GM12878 (female B-cells) | -0.95 | 1.29 | 1.33 |
Items per page:
1 – 2 of 2