rs529615 chr3:138594992 C>T
- Sequence
ccaacagggatgtcccatctaggg[C/T]atcagccaagggtctctcatcagg
- ASB in cell types
- PC9 (lung adenocarcinoma) HEK293 (embryonic kidney)
View in PheLiGe Color scale
-log10 FDR of Ref (C) ASB
-log10 FDR of Alt (T) ASB
Details
Transcription factors
Cell types
Cell type | Effect size Ref | Effect size Alt | FDR Ref | FDR Alt | Mean BAD | |
|---|---|---|---|---|---|---|
| PC9 (lung adenocarcinoma) | 1.72 | -0.86 | 2.00 | |||
| HEK293 (embryonic kidney) | 0.51 | 0.23 | 1.49 |
Items per page:
1 – 2 of 2
Motif analysis
No data available
Genetic associations
GRASP alcohol dependence symptoms, body mass index (bmi), comorbid depressive syndrome and alcohol dependence, ldl cholesterol, total cholesterol
GTEx eQTL Adipose_Subcutaneous, Artery_Aorta, Artery_Coronary, Artery_Tibial, Brain_Caudate_basal_ganglia, Brain_Cerebellar_Hemisphere, Brain_Cerebellum, Brain_Cortex, Brain_Frontal_Cortex_BA9, Brain_Hypothalamus, Brain_Nucleus_accumbens_basal_ganglia, Cells_Cultured_fibroblasts, Colon_Sigmoid, Colon_Transverse, Esophagus_Gastroesophageal_Junction, Esophagus_Mucosa, Esophagus_Muscularis, Heart_Left_Ventricle, Lung, Muscle_Skeletal, Nerve_Tibial, Pancreas, Skin_Not_Sun_Exposed_Suprapubic, Skin_Sun_Exposed_Lower_leg, Testis, Thyroid