rs530437500 chr16:67530247 G>C
- Sequence
ctcagccctggccaggcccggccc[G/C]ggggaggccgcctggctcccagcg
- ASB in cell types
- Human Umbilical Cord Blood-Derived Erythroid Progenitor Cells-2 (HUDEP-2)
View in PheLiGe Color scale
-log10 FDR of Ref (G) ASB
-log10 FDR of Alt (C) ASB
Details
Transcription factors
Cell types
Cell type | Effect size Ref | Effect size Alt | FDR Ref | FDR Alt | Mean BAD | |
|---|---|---|---|---|---|---|
| Human Umbilical Cord Blood-Derived Erythroid Progenitor Cells-2 (HUDEP-2) | 1.49 | -0.90 | 1.50 |
Items per page:
1 – 1 of 1