rs532010 chr6:151809783 A>G
- Sequence
actcaaaagacaaacaatgaacaa[A/G]acttttaaaggttggcatatttca
- ASB in cell types
- GM23248
View in PheLiGe Color scale
-log10 FDR of Ref (A) ASB
-log10 FDR of Alt (G) ASB
Details
Transcription factors
Cell types
Cell type | Effect size Ref | Effect size Alt | FDR Ref | FDR Alt | Mean BAD | |
|---|---|---|---|---|---|---|
| GM23248 | n/a | 1.39 | 1.25 |
Items per page:
1 – 1 of 1
Motif analysis
No data available
Genetic associations
GRASP amyotrophic lateral sclerosis (als) age of onset, breast cancer, height, hypertension (early onset hypertension), late onset alzheimers disease, maternal transmission distortion, nonalcoholic fatty liver disease (steatosis), spine bone mineral density (bmd), triglycerides change with statins