rs534812 chr11:75399908 G>A
- Sequence
gtcatttccctcatgtcttatccc[G/A]tggttttgggaagagaaggcagca
- ASB in cell types
- HEK293 (embryonic kidney) HEK293T (embryonic kidney)
View in PheLiGe Color scale
-log10 FDR of Ref (G) ASB
-log10 FDR of Alt (A) ASB
Details
Transcription factors
Cell types
Cell type | Effect size Ref | Effect size Alt | FDR Ref | FDR Alt | Mean BAD | |
|---|---|---|---|---|---|---|
| HEK293 (embryonic kidney) | 0.28 | 0.43 | 1.28 | |||
| HEK293T (embryonic kidney) | 0.94 | -0.17 | 2.00 |
Items per page:
1 – 2 of 2