rs534932 chr6:116104442 T>C
- Sequence
tggagaaactcaaaagtgcctcaa[T/C]gagaggcaaatctaaggtgtacaa
- ASB in cell types
- HepG2 (hepatoblastoma)
View in PheLiGe Color scale
-log10 FDR of Ref (T) ASB
-log10 FDR of Alt (C) ASB
Details
Transcription factors
Cell types
Cell type | Effect size Ref | Effect size Alt | FDR Ref | FDR Alt | Mean BAD | |
|---|---|---|---|---|---|---|
| HepG2 (hepatoblastoma) | 1.20 | -0.48 | 2.00 |
Items per page:
1 – 1 of 1
Motif analysis
No data available
Genetic associations
GRASP advanced age-related macular degeneration, advanced age-related macular degeneration (choroidal neovascularization) vs. no amd, advanced age-related macular degeneration (geographic atrophy), bipolar disorder versus schizophrenia, chronic kidney disease, height, ldl cholesterol, lung function, forced expiratory volume in 1 second (fev1), salmonella-induced pyroptosis, serum creatinine, stabilized warfarin dose, total cholesterol, triglycerides
GTEx eQTL Adipose_Subcutaneous, Adipose_Visceral_Omentum, Artery_Aorta, Artery_Tibial, Brain_Caudate_basal_ganglia, Brain_Cerebellum, Brain_Spinal_cord_cervical_c-1, Cells_Cultured_fibroblasts, Cells_EBV-transformed_lymphocytes, Esophagus_Mucosa, Muscle_Skeletal, Nerve_Tibial, Pituitary, Spleen, Testis, Thyroid, Whole_Blood