rs535248 chr9:126940688 A>G
- Sequence
atctcctgacctcgtgatccgtcg[A/G]acaggtatattcttatgctgttgt
- ASB in cell types
- foreskin keratinocyte MCF7 (Invasive ductal breast carcinoma)
View in PheLiGe Color scale
-log10 FDR of Ref (A) ASB
-log10 FDR of Alt (G) ASB
Details
Transcription factors
Cell types
Cell type | Effect size Ref | Effect size Alt | FDR Ref | FDR Alt | Mean BAD | |
|---|---|---|---|---|---|---|
| foreskin keratinocyte | n/a | 0.68 | 2.50 | |||
| MCF7 (Invasive ductal breast carcinoma) | 0.21 | 0.58 | 1.71 |
Items per page:
1 – 2 of 2