rs535991 chr16:5366312 G>A
- Sequence
catgacgattttgatgatgatgaa[G/A]atgatgatgatgatgattttgatg
- ASB in cell types
- A549 (lung carcinoma) HepG2 (hepatoblastoma)
View in PheLiGe Color scale
-log10 FDR of Ref (G) ASB
-log10 FDR of Alt (A) ASB
Details
Transcription factors
Cell types
Cell type | Effect size Ref | Effect size Alt | FDR Ref | FDR Alt | Mean BAD | |
|---|---|---|---|---|---|---|
| A549 (lung carcinoma) | n/a | 1.92 | 2.00 | |||
| HepG2 (hepatoblastoma) | -1.98 | 0.73 | 2.50 |
Items per page:
1 – 2 of 2