rs536857 chr1:156141496 A>G
- Sequence
tggggaacaccaggggcagcaggc[A/G]acgttcctagctcttgaggaggag
- ASB in cell types
- K562 (myelogenous leukemia) foreskin keratinocyte GM12878 (female B-cells) A549 (lung carcinoma)
- ASB for transcription factors
- KDM1A_HUMAN CTCF_HUMAN
View in PheLiGe Color scale
-log10 FDR of Ref (A) ASB
-log10 FDR of Alt (G) ASB
Details
Transcription factors
Cell types
Uniprot ID | Effect size Ref | Effect size Alt | FDR Ref | FDR Alt | Mean BAD | Motif fold change | Motif concordance | |
|---|---|---|---|---|---|---|---|---|
| KDM1A_HUMAN | 1.54 | -1.41 | 2.00 | n/a | n/a | |||
| CTCF_HUMAN | 0.67 | 0.54 | 1.39 | 3.24 | Discordant |
Items per page:
1 – 2 of 2
Motif analysis
