rs537886 chr11:124071979 A>G
- Sequence
tcatcattcctcttctgagctagc[A/G]gagaagggaatttgacttcttttt
- ASB in cell types
- PC9 (lung adenocarcinoma) K562 (myelogenous leukemia)
View in PheLiGe Color scale
-log10 FDR of Ref (A) ASB
-log10 FDR of Alt (G) ASB
Details
Transcription factors
Cell types
Cell type | Effect size Ref | Effect size Alt | FDR Ref | FDR Alt | Mean BAD | |
|---|---|---|---|---|---|---|
| PC9 (lung adenocarcinoma) | -1.58 | 1.51 | 1.33 | |||
| K562 (myelogenous leukemia) | 0.50 | -0.18 | 2.02 |
Items per page:
1 – 2 of 2