rs539298 chr6:160349328 A>G
- Sequence
ggcgaaccaacgtttgaaggcagc[A/G]gcagcttttttccagttgcccaaa
- ASB in cell types
- GM23248 HepG2 (hepatoblastoma)
View in PheLiGe Color scale
-log10 FDR of Ref (A) ASB
-log10 FDR of Alt (G) ASB
Details
Transcription factors
Cell types
Cell type | Effect size Ref | Effect size Alt | FDR Ref | FDR Alt | Mean BAD | |
|---|---|---|---|---|---|---|
| GM23248 | 0.60 | 1.51 | 1.25 | |||
| HepG2 (hepatoblastoma) | -0.52 | 1.00 | 2.00 |
Items per page:
1 – 2 of 2
Motif analysis
No data available
Genetic associations
GRASP aortic valve calcium, body mass index (bmi), coronary artery disease (cad), height, homa-b, ldl cholesterol, lipoprotein a (lp(a)), tetrology of fallot, total cholesterol, triglycerides
GTEx eQTL Adipose_Subcutaneous, Adipose_Visceral_Omentum, Brain_Caudate_basal_ganglia, Brain_Cortex, Brain_Frontal_Cortex_BA9, Brain_Nucleus_accumbens_basal_ganglia, Brain_Putamen_basal_ganglia, Cells_Cultured_fibroblasts, Esophagus_Mucosa, Heart_Left_Ventricle, Liver, Lung, Nerve_Tibial, Ovary, Skin_Not_Sun_Exposed_Suprapubic, Skin_Sun_Exposed_Lower_leg, Testis, Thyroid