rs540389 chr11:63970872 G>C
- Sequence
acacagctccccttctagggcacc[G/C]cgagttcattgcaaccttgctgtg
- ASB in cell types
- K562 (myelogenous leukemia)
View in PheLiGe Color scale
-log10 FDR of Ref (G) ASB
-log10 FDR of Alt (C) ASB
Details
Transcription factors
Cell types
Cell type | Effect size Ref | Effect size Alt | FDR Ref | FDR Alt | Mean BAD | |
|---|---|---|---|---|---|---|
| K562 (myelogenous leukemia) | -0.37 | 0.60 | 2.00 |
Items per page:
1 – 1 of 1
Motif analysis
No data available
Genetic associations
GRASP bipolar disorder, birth weight, hdl cholesterol change with statins, homa-b, major depressive disorder (narrow definition), major depressive disorder (narrow definition) (females), systolic blood pressure (sbp)
GTEx eQTL Adipose_Subcutaneous, Cells_Cultured_fibroblasts, Pancreas, Skin_Not_Sun_Exposed_Suprapubic, Skin_Sun_Exposed_Lower_leg, Spleen, Thyroid, Whole_Blood