rs540878 chr10:30186125 G>T
- Sequence
tattttggctcagtgatctggcca[G/T]ccattgcttagtgaccacaaatta
- ASB in cell types
- SK-N-SH (neuroblastoma)
- ASB for transcription factors
- EP300_HUMAN
View in PheLiGe Color scale
-log10 FDR of Ref (G) ASB
-log10 FDR of Alt (T) ASB
Details
Transcription factors
Cell types
Uniprot ID | Effect size Ref | Effect size Alt | FDR Ref | FDR Alt | Mean BAD | Motif fold change | Motif concordance | |
|---|---|---|---|---|---|---|---|---|
| EP300_HUMAN | 1.53 | -1.78 | 1.33 | n/a | n/a |
Items per page:
1 – 1 of 1