rs540909 chr9:273160 T>C
- Sequence
aaggataatttgtgtgttgcgtca[T/C]taatgaaatagtagtacgaaaaac
- ASB in cell types
- GM12878 (female B-cells)
View in PheLiGe Color scale
-log10 FDR of Ref (T) ASB
-log10 FDR of Alt (C) ASB
Details
Transcription factors
Cell types
Cell type | Effect size Ref | Effect size Alt | FDR Ref | FDR Alt | Mean BAD | |
|---|---|---|---|---|---|---|
| GM12878 (female B-cells) | 0.49 | 0.81 | 1.29 |
Items per page:
1 – 1 of 1
Motif analysis
No data available
Genetic associations
GRASP aortic valve calcium, celiac disease, chronic kidney disease, fasting insulin, sporadic creutzfeldt-jakob disease, systolic blood pressure (sbp)
GTEx eQTL Adipose_Subcutaneous, Adipose_Visceral_Omentum, Artery_Tibial, Breast_Mammary_Tissue, Cells_Cultured_fibroblasts, Colon_Transverse, Esophagus_Gastroesophageal_Junction, Esophagus_Mucosa, Esophagus_Muscularis, Heart_Atrial_Appendage, Lung, Muscle_Skeletal, Nerve_Tibial, Pancreas, Prostate, Skin_Not_Sun_Exposed_Suprapubic, Skin_Sun_Exposed_Lower_leg, Spleen, Stomach, Testis, Thyroid, Whole_Blood