rs541738 chr6:101607139 G>A
- Sequence
ataaggatatatgttggctcttat[G/A]tgtctattgggagaaatccattct
- ASB in cell types
- MCF7 (Invasive ductal breast carcinoma)
- ASB for transcription factors
- ESR1_HUMAN
View in PheLiGe Color scale
-log10 FDR of Ref (G) ASB
-log10 FDR of Alt (A) ASB
Details
Transcription factors
Cell types
Uniprot ID | Effect size Ref | Effect size Alt | FDR Ref | FDR Alt | Mean BAD | Motif fold change | Motif concordance | |
|---|---|---|---|---|---|---|---|---|
| ESR1_HUMAN | 0.97 | -0.13 | 1.50 | n/a | No Hit |
Items per page:
1 – 1 of 1
Motif analysis
No data available
Genetic associations
GRASP advanced age-related macular degeneration (choroidal neovascularization) vs. no amd, cognitive response of healthy volunteers to topiramate treatment as measure by the trailsb cognitive test, cognitive response to topiramate treatment, comorbid depressive syndrome and alcohol dependence, eye color, ldl cholesterol change with statins, maternal transmission distortion, total cholesterol change with statins, transmission distortion