rs542007 chr10:77246160 A>C
- Sequence
ctcattaaaccccatcagttactt[A/C]cacaatctggaaatttacttcttg
- ASB in cell types
- SUM159PT (pleiomorphic breast carcinoma) mesenchymal stem cells
- ASB for transcription factors
- TF65_HUMAN
View in PheLiGe Color scale
-log10 FDR of Ref (A) ASB
-log10 FDR of Alt (C) ASB
Details
Transcription factors
Cell types
Uniprot ID | Effect size Ref | Effect size Alt | FDR Ref | FDR Alt | Mean BAD | Motif fold change | Motif concordance | |
|---|---|---|---|---|---|---|---|---|
| TF65_HUMAN | 1.04 | n/a | 2.50 | n/a | No Hit |
Items per page:
1 – 1 of 1
Motif analysis
No data available
Genetic associations
GRASP barnes akathisia rating scale, bipolar disorder, ldl cholesterol change with statins, neuroticism, total cholesterol