rs542301 chr9:133133850 C>G
- Sequence
gcacctttctaggtaggggcaggc[C/G]ctggctgggtgtgaggcccattgt
- ASB in cell types
- MCF7 (Invasive ductal breast carcinoma) upper lobe of left lung HT29 (colon adenocarcinoma) GM12878 (female B-cells)
- ASB for transcription factors
- MAX_HUMAN
View in PheLiGe Color scale
-log10 FDR of Ref (C) ASB
-log10 FDR of Alt (G) ASB
Details
Transcription factors
Cell types
Uniprot ID | Effect size Ref | Effect size Alt | FDR Ref | FDR Alt | Mean BAD | Motif fold change | Motif concordance | |
|---|---|---|---|---|---|---|---|---|
| MAX_HUMAN | 0.91 | -0.27 | 1.52 | n/a | No Hit |
Items per page:
1 – 1 of 1
Motif analysis
No data available
Genetic associations
GTEx eQTL Brain_Caudate_basal_ganglia, Brain_Putamen_basal_ganglia, Esophagus_Muscularis, Nerve_Tibial, Skin_Not_Sun_Exposed_Suprapubic, Skin_Sun_Exposed_Lower_leg