rs542349 chr1:183368798 A>G
- Sequence
ttaattggatgtattccccagtag[A/G]ttcatagttcttttgttcttgctt
- ASB for transcription factors
- EMSY_HUMAN
View in PheLiGe Color scale
-log10 FDR of Ref (A) ASB
-log10 FDR of Alt (G) ASB
Details
Transcription factors
Cell types
Uniprot ID | Effect size Ref | Effect size Alt | FDR Ref | FDR Alt | Mean BAD | Motif fold change | Motif concordance | |
|---|---|---|---|---|---|---|---|---|
| EMSY_HUMAN | 2.12 | n/a | 3.00 | n/a | n/a |
Items per page:
1 – 1 of 1
Motif analysis
No data available
Genetic associations
GRASP arthritis including non-rheumatoid, chronic kidney disease, infant head circumference, ldl cholesterol, prop taste detection threshold, pulse rate, recurrent major depressive disorder, schizophrenia, total cholesterol