rs542437 chr3:191417340 A>C
- Sequence
aaagcagtactttatcaatgagta[A/C]acatatctcattgtgtttcaaaga
- ASB in cell types
- OCI-LY7 (diffuse large B-cell lymphoma)
View in PheLiGe Color scale
-log10 FDR of Ref (A) ASB
-log10 FDR of Alt (C) ASB
Details
Transcription factors
Cell types
Cell type | Effect size Ref | Effect size Alt | FDR Ref | FDR Alt | Mean BAD | |
|---|---|---|---|---|---|---|
| OCI-LY7 (diffuse large B-cell lymphoma) | 1.28 | -1.04 | 1.17 |
Items per page:
1 – 1 of 1