rs542474 chr8:101891655 T>C
- Sequence
agtgggcgcaggccagtgggtgcg[T/C]gcaccgagtgcgagccgaagcagg
- ASB in cell types
- K562 (myelogenous leukemia) MCF7 (Invasive ductal breast carcinoma)
View in PheLiGe Color scale
-log10 FDR of Ref (T) ASB
-log10 FDR of Alt (C) ASB
Details
Transcription factors
Cell types
Cell type | Effect size Ref | Effect size Alt | FDR Ref | FDR Alt | Mean BAD | |
|---|---|---|---|---|---|---|
| K562 (myelogenous leukemia) | 0.79 | -0.04 | 2.01 | |||
| MCF7 (Invasive ductal breast carcinoma) | 0.76 | 0.03 | 1.55 |
Items per page:
1 – 2 of 2