rs543293 chr11:86109035 A>G
- Sequence
ccaaaagtcaagagaaattgaaag[A/G]ctttgggcagtggttaagcagcta
- ASB in cell types
- K562 (myelogenous leukemia)
View in PheLiGe Color scale
-log10 FDR of Ref (A) ASB
-log10 FDR of Alt (G) ASB
Details
Transcription factors
Cell types
Cell type | Effect size Ref | Effect size Alt | FDR Ref | FDR Alt | Mean BAD | |
|---|---|---|---|---|---|---|
| K562 (myelogenous leukemia) | 0.32 | 0.21 | 2.00 |
Items per page:
1 – 1 of 1
Motif analysis
No data available
Genetic associations
GRASP adiponectin levels, alzheimers disease, alzheimers disease with psychotic symptoms (alzheimers disease with psychotic symptoms v. controls), barnes akathisia rating scale, body mass index (bmi), late onset alzheimers disease, mean entorhinal cortical thickness, mitral annular calcium, parkinsons disease, waist hip ratio, years of education