rs543410 chr12:57431587 C>T
- Sequence
ctcccccgttttgtccattctagg[C/T]agaatcaatttagttattgattat
- ASB in cell types
- K562 (myelogenous leukemia) GM12878 (female B-cells)
View in PheLiGe Color scale
-log10 FDR of Ref (C) ASB
-log10 FDR of Alt (T) ASB
Details
Transcription factors
Cell types
Cell type | Effect size Ref | Effect size Alt | FDR Ref | FDR Alt | Mean BAD | |
|---|---|---|---|---|---|---|
| K562 (myelogenous leukemia) | 0.84 | -0.13 | 2.01 | |||
| GM12878 (female B-cells) | 0.69 | 0.37 | 1.22 |
Items per page:
1 – 2 of 2
Motif analysis
No data available
Genetic associations
GRASP 2 hour glucose, fasting blood glucose, ldl cholesterol, microalbuminuria, serum creatinine, total cholesterol, triglycerides, waist hip ratio
GTEx eQTL Adipose_Visceral_Omentum, Artery_Aorta, Artery_Tibial, Cells_Cultured_fibroblasts, Cells_EBV-transformed_lymphocytes, Colon_Sigmoid, Esophagus_Gastroesophageal_Junction, Esophagus_Mucosa, Esophagus_Muscularis, Heart_Atrial_Appendage, Lung, Muscle_Skeletal, Nerve_Tibial, Skin_Not_Sun_Exposed_Suprapubic, Skin_Sun_Exposed_Lower_leg, Stomach, Testis, Thyroid, Whole_Blood