rs543589 chr1:66271377 A>C
- Sequence
acatttttgtactgctgagaaaca[A/C]catccacccaccctccccttgaaa
- ASB in cell types
- HEK293 (embryonic kidney) HEK293T (embryonic kidney) MCF7 (Invasive ductal breast carcinoma)
View in PheLiGe Color scale
-log10 FDR of Ref (A) ASB
-log10 FDR of Alt (C) ASB
Details
Transcription factors
Cell types
Cell type | Effect size Ref | Effect size Alt | FDR Ref | FDR Alt | Mean BAD | |
|---|---|---|---|---|---|---|
| HEK293 (embryonic kidney) | 1.12 | -0.01 | 1.99 | |||
| HEK293T (embryonic kidney) | 0.05 | 1.05 | 1.50 | |||
| MCF7 (Invasive ductal breast carcinoma) | 1.01 | -0.14 | 2.02 |
Items per page:
1 – 3 of 3