rs544302 chr8:13043738 A>G
- Sequence
taacaatacaggaaattgaaggaa[A/G]ccatctgaaacttcaacgtcgggc
- ASB in cell types
- primary endothelial colony-forming cells
- ASB for transcription factors
- TAL1_HUMAN
View in PheLiGe Color scale
-log10 FDR of Ref (A) ASB
-log10 FDR of Alt (G) ASB
Details
Transcription factors
Cell types
Uniprot ID | Effect size Ref | Effect size Alt | FDR Ref | FDR Alt | Mean BAD | Motif fold change | Motif concordance | |
|---|---|---|---|---|---|---|---|---|
| TAL1_HUMAN | 1.80 | -1.35 | 1.50 | n/a | No Hit |
Items per page:
1 – 1 of 1
Motif analysis
No data available
Genetic associations
GRASP fasting insulin, hypertension (early onset hypertension), major depressive disorder, tetrology of fallot