rs544941 chr1:111769712 A>T
- Sequence
gtttccagttatttctacccgaag[A/T]ttatttggtctgtgggtctgcagt
- ASB in cell types
- neutrophils CD34+ hematopoietic stem cells
View in PheLiGe Color scale
-log10 FDR of Ref (A) ASB
-log10 FDR of Alt (T) ASB
Details
Transcription factors
Cell types
Cell type | Effect size Ref | Effect size Alt | FDR Ref | FDR Alt | Mean BAD | |
|---|---|---|---|---|---|---|
| neutrophils | 1.92 | -0.39 | 1.67 | |||
| CD34+ hematopoietic stem cells | 1.88 | -1.59 | 2.00 |
Items per page:
1 – 2 of 2