rs545368 chr12:128976322 A>G
- Sequence
tgaaccccaccctccacccaccca[A/G]tcagtatctcggggactgagggcg
- ASB in cell types
- PANC1 (pancreatic ductal adenocarcinoma) neural cell
View in PheLiGe Color scale
-log10 FDR of Ref (A) ASB
-log10 FDR of Alt (G) ASB
Details
Transcription factors
Cell types
Cell type | Effect size Ref | Effect size Alt | FDR Ref | FDR Alt | Mean BAD | |
|---|---|---|---|---|---|---|
| PANC1 (pancreatic ductal adenocarcinoma) | 2.28 | -3.05 | 2.00 | |||
| neural cell | -0.37 | 0.63 | 1.00 |
Items per page:
1 – 2 of 2