rs546209586 chr8:124881872 G>A
- Sequence
gaggctgcagtgagccgtgattgc[G/A]ccactgctctccagcctgtgtgac
- ASB in cell types
- MCF7 (Invasive ductal breast carcinoma)
View in PheLiGe Color scale
-log10 FDR of Ref (G) ASB
-log10 FDR of Alt (A) ASB
Details
Transcription factors
Cell types
Cell type | Effect size Ref | Effect size Alt | FDR Ref | FDR Alt | Mean BAD | |
|---|---|---|---|---|---|---|
| MCF7 (Invasive ductal breast carcinoma) | 2.14 | -2.55 | 1.50 |
Items per page:
1 – 1 of 1