rs546230 chr2:126981692 G>T
- Sequence
gctgtttgctgcgcctctgagtca[G/T]caaacattggcaaaggaatctgaa
- ASB in cell types
- HepG2 (hepatoblastoma)
- ASB for transcription factors
- FOXA3_HUMAN
View in PheLiGe Color scale
-log10 FDR of Ref (G) ASB
-log10 FDR of Alt (T) ASB
Details
Transcription factors
Cell types
Uniprot ID | Effect size Ref | Effect size Alt | FDR Ref | FDR Alt | Mean BAD | Motif fold change | Motif concordance | |
|---|---|---|---|---|---|---|---|---|
| FOXA3_HUMAN | 2.37 | n/a | 2.00 | n/a | No Hit |
Items per page:
1 – 1 of 1
Motif analysis
No data available
Genetic associations
GRASP abnormal involuntary movement scale, crohns disease, combined control dataset, gender differentiated, triglycerides