rs546696 chr18:619050 G>T
- Sequence
aaggtatggtccgtgtggcagctg[G/T]gtccatgtggcagctgacagctaa
- ASB in cell types
- K562 (myelogenous leukemia)
- ASB for transcription factors
- ARI1B_HUMAN MEIS2_HUMAN
View in PheLiGe Color scale
-log10 FDR of Ref (G) ASB
-log10 FDR of Alt (T) ASB
Details
Transcription factors
Cell types
Uniprot ID | Effect size Ref | Effect size Alt | FDR Ref | FDR Alt | Mean BAD | Motif fold change | Motif concordance | |
|---|---|---|---|---|---|---|---|---|
| ARI1B_HUMAN | 1.92 | -1.95 | 1.33 | n/a | n/a | |||
| MEIS2_HUMAN | 1.64 | n/a | 1.33 | n/a | No Hit |
Items per page:
1 – 2 of 2
Motif analysis
No data available
Genetic associations
GRASP age at death with kuru exposure, aortic valve calcium, diastolic blood pressure (dbp), hdl cholesterol, neuroblastoma (brain cancer), systolic blood pressure (sbp)