rs5468 chr16:72054432 T>G
- Sequence
tgccaggtttcttgggatttgtaa[T/G]agaacatcacaagaaaatcaagtg
- ASB in cell types
- HepG2 (hepatoblastoma)
View in PheLiGe Color scale
-log10 FDR of Ref (T) ASB
-log10 FDR of Alt (G) ASB
Details
Transcription factors
Cell types
Cell type | Effect size Ref | Effect size Alt | FDR Ref | FDR Alt | Mean BAD | |
|---|---|---|---|---|---|---|
| HepG2 (hepatoblastoma) | -0.10 | 0.83 | 1.99 |
Items per page:
1 – 1 of 1
Motif analysis
No data available
Genetic associations
GRASP circulating haptoglobin levels, coronary artery disease (cad), maternal transmission distortion, mitral annular calcium, rheumatoid arthritis, systolic blood pressure (sbp), total cholesterol, transmission distortion