rs548181 chr11:125591814 A>G
- Sequence
aggcaacaagttcgaagagctgcg[A/G]gacgttcccactctctctggtgta
- ASB in cell types
- T47D (invasive ductal carcinoma) GM12878 (female B-cells)
- ASB for transcription factors
- HIF1A_HUMAN HIF3A_HUMAN
View in PheLiGe Color scale
-log10 FDR of Ref (A) ASB
-log10 FDR of Alt (G) ASB
Details
Transcription factors
Cell types
Uniprot ID | Effect size Ref | Effect size Alt | FDR Ref | FDR Alt | Mean BAD | Motif fold change | Motif concordance | |
|---|---|---|---|---|---|---|---|---|
| HIF1A_HUMAN | n/a | 2.62 | 2.00 | n/a | No Hit | |||
| HIF3A_HUMAN | n/a | 1.97 | 2.00 | n/a | n/a |
Items per page:
1 – 2 of 2
Motif analysis
No data available
Genetic associations
EMBL-EBI autism spectrum disorder, attention deficit-hyperactivity disorder, bipolar disorder, major depressive disorder, and schizophrenia (combined), schizophrenia
GRASP birth weight, hdl cholesterol change with statins, height, schizophrenia, triglycerides, waist hip ratio, years of education
GTEx eQTL Adipose_Subcutaneous, Brain_Cerebellar_Hemisphere, Brain_Cerebellum, Esophagus_Mucosa, Esophagus_Muscularis, Nerve_Tibial, Skin_Sun_Exposed_Lower_leg, Testis, Thyroid