rs548234 chr6:106120159 C>T
- Sequence
aaagcaatttttgtcttctctcac[C/T]cttgtcttgacttttccttctttg
- ASB in cell types
- K562 (myelogenous leukemia)
View in PheLiGe Color scale
-log10 FDR of Ref (C) ASB
-log10 FDR of Alt (T) ASB
Details
Transcription factors
Cell types
Cell type | Effect size Ref | Effect size Alt | FDR Ref | FDR Alt | Mean BAD | |
|---|---|---|---|---|---|---|
| K562 (myelogenous leukemia) | 0.66 | 0.23 | 1.93 |
Items per page:
1 – 1 of 1
Motif analysis
No data available
Genetic associations
GRASP drug-induced liver injury-all dili cases with the combination antibiotic sulfamethoxazole/trimethoprim implicated, drug-induced liver injury-all mixed injury dili cases , fasting insulin, height, homa-b, homa-ir, joint damage severity in rheumatoid arthritis, neuroticism, rheumatoid arthritis, rheumatoid arthritis, combined control dataset, selective immunoglobulin a deficiency (igad), systemic lupus erythematosus (sle), triglycerides change with statins
PheWAS aneurysm of iliac artery, arthropathy associated with neurological disorders, arthropathy associated with other disorders classified elsewhere, arthropathy nos, bacterial infection nos, benign neoplasm of thyroid glands, bipolar, cholecystitis without cholelithiasis, chronic hepatitis, congenital anomalies of posterior segment of eye, contact dermatitis and other eczema due to plants [except food], contracture of joint, dermatomycoses, diabetes mellitus, diabetic retinopathy, discoid lupus erythematosus, disease of tricuspid valve, diseases of the oral soft tissues, disorders of lacrimal system, disorders of the autonomic nervous system, disturbance of salivary secretion, drug-resistant infection, dry eyes, endometrial hyperplasia, essential tremor, facial nerve disorders, genitourinary congenital anomalies, gram positive septicemia, heart valve disorders, hemorrhage nos, hereditary hemolytic anemias, hirsutism, hodgkins disease, iatrogenic hypotension, inflammatory and toxic neuropathy, insulin pump user, labyrinthitis, lupus erythematosus, mastoiditis, methicillin sensitive staphylococcus aureus, nervous system congenital anomalies, nonrheumatic aortic valve disorders, nonrheumatic mitral valve disorders, nontoxic multinodular goiter, osteoporosis, osteopenia, & pathological fractures, other disorders of bone and cartilage, other disorders of gallbladder, other hemoglobinopathies, other hypertensive complications, other specified disorders of breast, otitis externa, pervasive developmental disorders, pityriasis, polyarthropathy or polyarthritis involving multiple sites nos, pruritus and related conditions, rotator cuff (capsule) sprain, senile dementia, sepsis, sepsis and sirs, septicemia, severe protein-calorie malnutrition, sexually transmitted infections, shock, sprains and strains, staphylococcus infections, sulfonamides, systemic lupus erythematosus, thyroiditis, type 2 diabetes, type 2 diabetic neuropathy, type 2 diabetic peripheral circulatory disorders, ulcerative colitis, ulcerative stomatitis & mucositis, unspecified osteomyelitis, uterine cancer