Attention! You are using release Soos. You can switch to the latest ADASTRA version: adastra.autosome.org

rs548234 chr6:106120159 C>T

Sequence
aaagcaatttttgtcttctctcac[C/T]cttgtcttgacttttccttctttg
ASB in cell types
K562 (myelogenous leukemia)

Color scale

color scale ref
-log10 FDR of Ref (C) ASB
color scale alt
-log10 FDR of Alt (T) ASB

Details

Cell type
Effect size Ref
Effect size Alt
FDR Ref
FDR Alt
Mean BAD
K562 (myelogenous leukemia) 0.66 0.23 0.030.89 1.93
Items per page:
1 – 1 of 1

Motif analysis

No data available

Genetic associations

EMBL-EBI systemic lupus erythematosus
GRASP drug-induced liver injury-all dili cases with the combination antibiotic sulfamethoxazole/trimethoprim implicated drug-induced liver injury-all mixed injury dili cases fasting insulin height homa-b homa-ir joint damage severity in rheumatoid arthritis neuroticism rheumatoid arthritis rheumatoid arthritis, combined control dataset selective immunoglobulin a deficiency (igad) systemic lupus erythematosus (sle) triglycerides change with statins
PheWAS aneurysm of iliac artery arthropathy associated with neurological disorders arthropathy associated with other disorders classified elsewhere arthropathy nos bacterial infection nos benign neoplasm of thyroid glands bipolar cholecystitis without cholelithiasis chronic hepatitis congenital anomalies of posterior segment of eye contact dermatitis and other eczema due to plants [except food] contracture of joint dermatomycoses diabetes mellitus diabetic retinopathy discoid lupus erythematosus disease of tricuspid valve diseases of the oral soft tissues disorders of lacrimal system disorders of the autonomic nervous system disturbance of salivary secretion drug-resistant infection dry eyes endometrial hyperplasia essential tremor facial nerve disorders genitourinary congenital anomalies gram positive septicemia heart valve disorders hemorrhage nos hereditary hemolytic anemias hirsutism hodgkins disease iatrogenic hypotension inflammatory and toxic neuropathy insulin pump user labyrinthitis lupus erythematosus mastoiditis methicillin sensitive staphylococcus aureus nervous system congenital anomalies nonrheumatic aortic valve disorders nonrheumatic mitral valve disorders nontoxic multinodular goiter osteoporosis, osteopenia, & pathological fractures other disorders of bone and cartilage other disorders of gallbladder other hemoglobinopathies other hypertensive complications other specified disorders of breast otitis externa pervasive developmental disorders pityriasis polyarthropathy or polyarthritis involving multiple sites nos pruritus and related conditions rotator cuff (capsule) sprain senile dementia sepsis sepsis and sirs septicemia severe protein-calorie malnutrition sexually transmitted infections shock sprains and strains staphylococcus infections sulfonamides systemic lupus erythematosus thyroiditis type 2 diabetes type 2 diabetic neuropathy type 2 diabetic peripheral circulatory disorders ulcerative colitis ulcerative stomatitis & mucositis unspecified osteomyelitis uterine cancer
Finemapping systemic lupus erythematosus

Download