rs550743 chr1:108963067 T>C
- Sequence
aagccaacagaattcaacgtgcgc[T/C]caggtctcgctttgccctcgctgt
- ASB in cell types
- GM12878 (female B-cells)
View in PheLiGe Color scale
-log10 FDR of Ref (T) ASB
-log10 FDR of Alt (C) ASB
Details
Transcription factors
Cell types
Cell type | Effect size Ref | Effect size Alt | FDR Ref | FDR Alt | Mean BAD | |
|---|---|---|---|---|---|---|
| GM12878 (female B-cells) | 0.75 | 0.33 | 1.32 |
Items per page:
1 – 1 of 1
Motif analysis
No data available
Genetic associations
GRASP amyotrophic lateral sclerosis (als), hip bone mineral density (bmd), longstanding arthritis, microalbuminuria, paternal transmission distortion, tourettes syndrome
GTEx eQTL Adipose_Subcutaneous, Adipose_Visceral_Omentum, Artery_Aorta, Artery_Tibial, Cells_Cultured_fibroblasts, Esophagus_Mucosa, Esophagus_Muscularis, Heart_Atrial_Appendage, Lung, Skin_Sun_Exposed_Lower_leg, Stomach, Thyroid