rs552361 chr1:183198723 C>T
- Sequence
caaactgatctcatgctctgaggc[C/T]tgcctcatcgccttgccctcctcc
- ASB in cell types
- gastroesophageal sphincter
- ASB for transcription factors
- EP300_HUMAN IKZF1_HUMAN
View in PheLiGe Color scale
-log10 FDR of Ref (C) ASB
-log10 FDR of Alt (T) ASB
Details
Transcription factors
Cell types
Uniprot ID | Effect size Ref | Effect size Alt | FDR Ref | FDR Alt | Mean BAD | Motif fold change | Motif concordance | |
|---|---|---|---|---|---|---|---|---|
| EP300_HUMAN | -0.42 | 1.14 | 1.36 | n/a | n/a | |||
| IKZF1_HUMAN | n/a | 1.59 | 1.33 | n/a | No Hit |
Items per page:
1 – 2 of 2
Motif analysis
No data available
Genetic associations
GRASP body mass index (bmi), cystatin c in serum, ldl cholesterol, obesity with early age of onset (age >2), rheumatoid arthritis
GTEx eQTL Adipose_Subcutaneous, Adipose_Visceral_Omentum, Artery_Aorta, Artery_Tibial, Brain_Amygdala, Brain_Anterior_cingulate_cortex_BA24, Brain_Caudate_basal_ganglia, Brain_Cerebellar_Hemisphere, Brain_Cerebellum, Brain_Cortex, Brain_Frontal_Cortex_BA9, Brain_Hippocampus, Brain_Hypothalamus, Brain_Putamen_basal_ganglia, Cells_Cultured_fibroblasts, Colon_Sigmoid, Colon_Transverse, Esophagus_Gastroesophageal_Junction, Esophagus_Muscularis, Heart_Atrial_Appendage, Heart_Left_Ventricle, Muscle_Skeletal, Nerve_Tibial, Stomach, Uterus, Whole_Blood