rs553039 chr1:89763108 G>A
- Sequence
gcagccctccctggagtgagcggc[G/A]gccggggctccagataaggcgggc
- ASB in cell types
- foreskin keratinocyte CD14+ monocytes neutrophils CD34+ hematopoietic stem cells-derived proerythroblasts
- ASB for transcription factors
- CTCF_HUMAN STAT1_HUMAN RAD21_HUMAN GATA1_HUMAN
View in PheLiGe Color scale
-log10 FDR of Ref (G) ASB
-log10 FDR of Alt (A) ASB
Details
Transcription factors
Cell types
Uniprot ID | Effect size Ref | Effect size Alt | FDR Ref | FDR Alt | Mean BAD | Motif fold change | Motif concordance | |
|---|---|---|---|---|---|---|---|---|
| CTCF_HUMAN | 0.76 | 0.90 | 1.44 | n/a | No Hit | |||
| STAT1_HUMAN | -3.13 | 2.61 | 2.50 | n/a | No Hit | |||
| RAD21_HUMAN | -0.05 | 0.85 | 1.33 | n/a | n/a | |||
| GATA1_HUMAN | 0.04 | 1.54 | 1.83 | n/a | No Hit |
Items per page:
1 – 4 of 4
Motif analysis
No data available
Genetic associations
GTEx eQTL Adipose_Subcutaneous, Adipose_Visceral_Omentum, Adrenal_Gland, Artery_Aorta, Artery_Coronary, Brain_Anterior_cingulate_cortex_BA24, Brain_Caudate_basal_ganglia, Brain_Cerebellar_Hemisphere, Brain_Putamen_basal_ganglia, Breast_Mammary_Tissue, Cells_Cultured_fibroblasts, Colon_Transverse, Esophagus_Gastroesophageal_Junction, Esophagus_Muscularis, Heart_Atrial_Appendage, Heart_Left_Ventricle, Lung, Muscle_Skeletal, Nerve_Tibial, Skin_Not_Sun_Exposed_Suprapubic, Skin_Sun_Exposed_Lower_leg, Small_Intestine_Terminal_Ileum, Spleen, Stomach, Thyroid, Whole_Blood