rs554113 chr6:85405526 A>G
- Sequence
cctgtgcaaagtccaggatggaca[A/G]ctgccccaactctaaccagacaat
- ASB in cell types
- liver
View in PheLiGe Color scale
-log10 FDR of Ref (A) ASB
-log10 FDR of Alt (G) ASB
Details
Transcription factors
Cell types
Cell type | Effect size Ref | Effect size Alt | FDR Ref | FDR Alt | Mean BAD | |
|---|---|---|---|---|---|---|
| liver | 0.96 | -0.11 | 1.33 |
Items per page:
1 – 1 of 1
Motif analysis
No data available
Genetic associations
GTEx eQTL Adipose_Subcutaneous, Artery_Tibial, Brain_Amygdala, Brain_Anterior_cingulate_cortex_BA24, Brain_Caudate_basal_ganglia, Brain_Cortex, Brain_Frontal_Cortex_BA9, Brain_Nucleus_accumbens_basal_ganglia, Cells_EBV-transformed_lymphocytes, Colon_Transverse, Liver, Ovary, Spleen, Stomach, Testis, Thyroid, Vagina, Whole_Blood