rs554122 chr11:65266403 T>C
- Sequence
gcccttatcctcttttgtctcccc[T/C]cagtggtgagctttgtaaggacaa
- ASB in cell types
- K562 (myelogenous leukemia) HCT-116 (colon carcinoma) HCT-116-RAD21-mAC adrenal gland
- ASB for transcription factors
- CTCF_HUMAN KDM1A_HUMAN IKZF1_HUMAN NFIC_HUMAN
View in PheLiGe Color scale
-log10 FDR of Ref (T) ASB
-log10 FDR of Alt (C) ASB
Details
Transcription factors
Cell types
Uniprot ID | Effect size Ref | Effect size Alt | FDR Ref | FDR Alt | Mean BAD | Motif fold change | Motif concordance | |
|---|---|---|---|---|---|---|---|---|
| CTCF_HUMAN | -0.31 | 2.24 | 1.59 | 4.94 | Concordant | |||
| KDM1A_HUMAN | -3.88 | 2.55 | 2.00 | n/a | n/a | |||
| IKZF1_HUMAN | n/a | 2.72 | 2.00 | n/a | No Hit | |||
| NFIC_HUMAN | n/a | 2.29 | 2.00 | n/a | No Hit | |||
| RING2_HUMAN | -2.21 | 2.29 | 2.00 | n/a | n/a |
Items per page:
1 – 5 of 6
Motif analysis
Genetic associations
GTEx eQTL Adipose_Subcutaneous, Adipose_Visceral_Omentum, Adrenal_Gland, Artery_Aorta, Artery_Tibial, Breast_Mammary_Tissue, Cells_Cultured_fibroblasts, Cells_EBV-transformed_lymphocytes, Colon_Sigmoid, Colon_Transverse, Esophagus_Gastroesophageal_Junction, Esophagus_Mucosa, Esophagus_Muscularis, Heart_Left_Ventricle, Lung, Muscle_Skeletal, Nerve_Tibial, Pancreas, Prostate, Skin_Not_Sun_Exposed_Suprapubic, Skin_Sun_Exposed_Lower_leg, Stomach, Testis, Thyroid, Whole_Blood