rs555709 chr18:3605862 C>A
- Sequence
gtctatagatttttaaaagctagc[C/A]gtaaacaaaaaccaaaaagtttac
- ASB in cell types
- K562 (myelogenous leukemia) GM12878 (female B-cells)
View in PheLiGe Color scale
-log10 FDR of Ref (C) ASB
-log10 FDR of Alt (A) ASB
Details
Transcription factors
Cell types
Cell type | Effect size Ref | Effect size Alt | FDR Ref | FDR Alt | Mean BAD | |
|---|---|---|---|---|---|---|
| K562 (myelogenous leukemia) | 0.44 | 0.53 | 1.26 | |||
| GM12878 (female B-cells) | 0.52 | 0.26 | 1.31 |
Items per page:
1 – 2 of 2
Motif analysis
No data available
Genetic associations
GTEx eQTL Breast_Mammary_Tissue, Cells_Cultured_fibroblasts, Muscle_Skeletal, Nerve_Tibial, Pituitary, Thyroid, Whole_Blood